¿Qué es la programación informática? - Informáticas

¿Qué es la programación informática?


¿Qué es la programación informática? El sector de la economía que más ha crecido en las últimas décadas es la informática.

Por lo tanto, la importancia del sector de desarrollo de software está creciendo con la aparición de cientos de miles de aplicaciones y software para habilitar los dispositivos siempre nuevos que surgen.

Lo que encontrará aquí:

Comprenderá qué es la programación informática. ¿Qué usan para esto, qué lenguajes son los más populares y cuáles son todos los tipos de programación?
Estamos tan acostumbrados a utilizar software en nuestra vida diaria que la mayoría de los usuarios sufren una gran adicción al software.

La programación informática: La tecnología y el software 

 

Son herramientas que mejoran nuestra vida diaria de muchas formas y, cuando se utilizan correctamente, pueden ser nuestros mejores aliados.

¿Qué es la programación informática?

Todos estos programas, también llamados aplicaciones o más generalmente software, obviamente deben ser pensados ​​y desarrollados antes de que el usuario pueda usarlos en su dispositivo.

Esta tarea la realiza un programador, un profesional que en los últimos años se ha trasladado de los centros de desarrollo a los de investigación en el ámbito de las grandes empresas, para luego desarrollar programas en diversas áreas de la economía manufacturera, lo que hace que el proceso sea uno de los más demandados. recursos humanos.

En la medida de lo posible, el software es un elemento fundamental en estos días, por lo que la tecnología puede ocupar su lugar y el programador un profesional que puede moldear las necesidades de los usuarios. Si quieres aprender más sobre software, programadores y programación, en este post encontrarás todo lo que necesitas para entender este fascinante mundo.

Índice de contenido


• ¿Qué es la programación?
• ¿Para qué sirve la programación?
• ¿Por qué necesitarías aprender a programar?
• ¿Cómo se programa?
• ¿Cuántos lenguajes de programación necesito aprender?
• Algoritmos, programas y lenguajes de programación
• Ejemplo de algoritmo
• Ejemplos de programación
• Java
• JavaScript
• C ++
• PHP
• Perl
• Pitón
• Tipos de programación
• Programación estructurada
• Programación modular
• Programación lineal
• Programación orientada a objetos
• Programación paralela
• Programacion funcional
• Programación lógica


¿Qué es la programación?


Como se mencionó anteriormente, detrás de todo el software que usamos todos los días, existe un minucioso proceso de desarrollo y prueba que nos permite crear y ejecutar cualquier tipo de programa. Este proceso se llama programación, una tarea que muchos consideran un arte, y es fundamental para el tipo de sociedad en la que estamos inmersos hoy.

¿Qué es la programación informática?

De hecho, con la ayuda de la programación, podemos, paso a paso y con la ayuda de cierto código, configurar las funciones que tendrá el programa y cómo la computadora debe procesar el código especificado.

Para ello se utiliza un lenguaje de programación, del que hablaremos más adelante. Lo que hacemos en el software de idiomas, después de cierto proceso, se convierte en un programa de computadora.

Esta programación debe hacerse con órdenes, instrucciones y expresiones que generalmente se asemejan a un lenguaje muy simple, por esta razón el software que usamos para crear programas se llama lenguaje de programación.

Esta programación se realiza mediante la implementación de ciertos algoritmos, de los que también hablaremos más adelante, pero por ahora explicaremos principalmente como un conjunto de ciertas reglas que deben seguirse paso a paso para lograr un determinado objetivo.

¿Qué es la programación informática?

La informática, como ya hemos dicho, ocupa un lugar muy importante en la sociedad moderna, y por ello debemos conocer al menos mínimamente cuáles son sus características. Esto se debe principalmente a dos motivos: el primero de estos motivos es una comprensión más profunda de los procesos que se ejecutan en nuestros dispositivos, lo que nos permitiría resolver más fácilmente todo tipo de problemas, y también nos permitiría resolver para mejorar nuestro razonamiento lógico. 

La programación informática: La segunda razón para aprender a programar…

La segunda razón para aprender a programar es que la informática puede ser un entorno laboral muy importante, y la programación puede ser más que una interesante oportunidad laboral, principalmente porque programar no es una carrera para todos, es decir, tienen una deuda contigo. Por esta razón, al igual que los números y las estructuras, en la mayoría de los casos esta área se limita a quienes están bien versados ​​en áreas como las matemáticas.

Además, siempre habrá necesidad de un programador, tanto para proyectos grandes como pequeños, lo que significa que habrá vacantes muy interesantes que se pagan muy bien.

¿Qué es la programación informática?

¿Para qué sirve la programación?


La programación es básicamente la creación de software mediante programas de creación de software (IDE) utilizando un lenguaje de programación con el fin de satisfacer las necesidades computacionales de quienes necesitan resolver un problema o implementar nuevas funciones en una organización, empresa o incluso clientes privados.

Aprender a programar software y hacerlo bien es un arte, porque además de combinar nuestras habilidades con los números y todo tipo de operaciones matemáticas, también tenemos que usar nuestra creatividad, inteligencia e ingenio para que nuestro cliente encuentre lo que necesita en el programa. . que estamos desarrollando, y al mismo tiempo nos sentimos cómodos.

A pesar de lo fácil u obvio que parezca entender qué es la programación o para qué sirve, lo cierto es que mucha gente todavía no comprende ninguno de estos dos conceptos. Para ayudar a comprender qué significan ambas ideas, a partir de ahora encontraremos información que será de gran ayuda para comprender estos temas con claridad.

Como sabemos, una computadora es un dispositivo electrónico increíblemente poderoso que puede realizar todo tipo de tareas. Sin embargo, no puede hacer nada a menos que descargue y ejecute el programa, lo que significa que la computadora no planificada tiene el mismo valor de conocimiento que una licuadora u otro dispositivo.

 
¿Qué es la programación informática?

Esto significa que toda la energía escondida en los discos duros, la RAM o el procesador de la computadora está esperando que el programador le dé instrucciones para ejecutar, lo cual se hace usando un lenguaje de programación.

Entonces se podría decir que la programación es la definición de ciertas instrucciones en un orden determinado, las cuales deben ser ejecutadas por la computadora y así obtener un resultado determinado. Con estas sencillas instrucciones, crea un conjunto de comportamientos llamado programa.

¿Para qué sirve la programación?

A la pregunta … ¿Para qué sirve la programación? La respuesta apropiada que te ofrecemos es: «Para todo».

Aunque la respuesta pueda parecer algo ambigua, debemos tener en cuenta, y es muy importante, que las computadoras y los dispositivos electrónicos son utilizados por miles de millones de usuarios en todo el mundo, es decir, son responsables y nos ayudan en muchas de las tareas que realizamos todos los días, enumeración que llevaría mucho tiempo.

Los dispositivos electrónicos están en todas partes; en la industria, el comercio, el entretenimiento, la cultura, la educación y muchas otras áreas, y ya se han convertido en parte de la vida humana hasta tal punto que nos será muy difícil desvincularnos de sus funciones. Sin duda, un terreno fértil para programadores bien formados.

¿Qué es la programación informática?

¿Por qué necesitarías aprender a programar?


La mejor respuesta a esta pregunta está un poco más arriba en este artículo. Sin embargo, existen otras necesidades para las que aprender a codificar desde cero es una de las mejores ideas que podemos tener para el futuro.

Con el paso de los años, la programación se ha convertido en una especialidad cada vez más demandada, principalmente debido a que la tecnología ha evolucionado y se ha expandido, y con ello la necesidad de contar con profesionales capaces de crear aplicaciones con las que aprovechar y aprovechar estos hardware. desarrollos.

En este sentido, el desarrollo económico del programador ha crecido exponencialmente y nunca ha sido tan recompensado como ahora, ya que las oportunidades laborales en este sector crecen cada año, por cada tecnología nueva que nace o evoluciona. Hoy en día, aprender a desarrollar software es muy rentable.

Pero además de la posibilidad de que la programación sea una gran fuente de ingresos, aprender a programar también significa aprender a pensar, ya que la estructura y organización de los lenguajes de programación también nos permitirá resolver nuestros problemas de una manera mucho más definida. , gracias al razonamiento lógico, es decir, paso a paso y valoración de cada situación por separado.

¿Qué es la programación informática?

Ante este escenario negro, nada mejor que empezar a aprender a programar, lo que puede garantizarnos un futuro prometedor, y los que no lo entiendan se estancarán. Afortunadamente, mucha gente entiende que este escenario no es una película y que es bastante posible, y peor aún, factible.

Pero la formación fundamental en programación asegura el bienestar

Pero la formación fundamental en programación asegura el bienestar. La informática en este nivel es un área donde las recompensas monetarias son excelentes, pero también es mucho más saludable que otras áreas, ya que la mayoría de los profesionales de este sector son autónomos, lo que significa que no tienen que venir todos los días a trabajar en un lugar de trabajo que la mayor parte del tiempo es dañino.

Estos programadores que han dado este paso trabajan de forma autónoma y crean sus propios horarios, lo que les permite gestionar su tiempo y su salud, tanto mental como física.

Al mismo tiempo, aprender a programar, pero tomándolo en serio y esforzándonos por crearnos un futuro, es una de las alternativas laborales más interesantes que tenemos, ya que en poco tiempo estaremos completamente informatizados, y esto requerirá un legión. programadores para satisfacer todo este requisito.

¿Qué es la programación informática?

La programación informática: ¿Cómo se programa?


Al leer sobre los beneficios que puede traer aprender a programar, es probable que sintamos que vamos por este camino, sin embargo la verdad es que programar no es nada fácil, y realmente lo es para aquellos que realmente quieren asumir el desafío, comenzando en una carrera que asume el conocimiento de varias disciplinas del conocimiento.

aprender a programar…

Por supuesto, si queremos empezar a programar, estos escollos no serán un gran problema. En este punto, debe quedar claro que aprender a programar no implica conocimientos de física cuántica o matemáticas muy avanzadas, es simplemente una cuestión de usar lo que aprendimos en la escuela y agregarlo a todos los demás conocimientos que tenemos. adquirido a lo largo de nuestra vida. Por supuesto, también un título universitario en programación.

La programación se puede dividir…

La programación se puede dividir básicamente en dos aspectos claramente diferenciados: el puramente técnico, asociado al estudio de lenguajes de programación, y el aspecto comercial de la actividad, es decir, formas de posicionarse mejor para obtener mayores beneficios.

Aprender a programar es tan fácil como realmente queremos que sea. Podríamos decir que la programación es la ejecución de un software en un lenguaje de programación, estructurando una serie de secuencias según el tipo de lenguaje que estemos usando, y ahí es donde terminamos. Si bien se puede resumir así, lo cierto es que un buen programador tiene una base de conocimientos y una responsabilidad por lo que hace que lo separa del resto.

¿Qué es la programación informática?

Estos elementos se adquieren conociendo los errores y aciertos cometidos durante la formación y el desarrollo profesional, un conocimiento profundo de las herramientas que utilizas para programar y, sobre todo, la convicción de que necesitas hacer algo mejor que nadie. separarse del resto. Lograr este objetivo requiere no solo capacitación, sino también mantener la profesionalidad que debe marcar la diferencia. Ser programador no es solo saber programar, también es necesario tener políticas comerciales y de comportamiento.

siempre podrá obtener mejores oportunidades laborales que los demás…

Esto hara que aquel programador constante y profesional, aquel, que está continuamente estudiando a entregar lo mejor, experimentar de su propio trabajo y tener ética laboral, siempre podrá obtener mejores oportunidades laborales que los demás, ya que podrá ir más allá de los aspectos puramente técnicos para proporcionar a su cliente un software perfecto.

En este sentido, es inútil que el programador, por ejemplo, copie y pegue código o cláusulas estándar de otros programadores, ya que puede no cumplir con los requisitos del cliente. Un buen programador siempre creará su propia solución, con la que definitivamente logrará los mejores resultados. Y así, en todos los escenarios: haga todo lo posible para hacer feliz al cliente.

¿Qué es la programación informática?

Pero para ello es necesario estudiar más allá de lo absolutamente necesario y, lamentablemente, el camino que muchos están tomando. Un buen programador siempre se mantendrá al día con toda la documentación relevante de cada lenguaje de programación para conocerlo a la perfección y encontrar la mejor forma de hacer algo.

De hecho, un buen programador siempre se entrenará para hacer lo mejor que pueda. En esta etapa, el programador siempre debe recordar continuar aprendiendo. Además, explorará otras áreas más relacionadas con la atención al cliente, como la comunicación, es decir, sabe escuchar y entender lo que el cliente necesita y poder informar al cliente de lo que hemos hecho, además, el programador. Siempre conviene plantear las preguntas en primer lugar de acuerdo con las necesidades del cliente, y no con sus propias creencias o posiciones.

¿Cuántos lenguajes de programación necesito aprender?


La respuesta a esta pregunta es básicamente todo lo que existe. Un buen programador necesita conocer todas las herramientas disponibles en el mercado para poder evaluar cuál es la mejor para un trabajo en particular. Como sabemos las computadoras y otros dispositivos son ajenos a los lenguajes de programación, porque no pueden interpretarlos directamente, para ello existen otras herramientas como los lenguajes ensambladores y otras que convierten estas secuencias a un lenguaje binario, es decir, un lenguaje que los procesos entienden. y microprocesadores.

¿Qué es la programación informática?

Un lenguaje de Programación Específico…

Por esta razón, podemos utilizar un lenguaje de programación específico para necesidades específicas. En este sentido, los programadores más experimentados tienen muchos lenguajes de programación diferentes instalados en sus computadoras, y los utilizan de acuerdo a las necesidades del trabajo que están realizando. Si bien es mejor para los nuevos en la codificación aprender un lenguaje de programación flexible que le permita adaptarse a muchos escenarios, con el tiempo será necesario aprender tantos como sea posible de acuerdo con nuestra especialización.

Sin embargo, aquí no estamos hablando de mirarlos para entender más o menos cómo funcionan. Decimos que es necesario aprender a fondo el lenguaje de programación para poder sacarles el máximo partido y aplicarlos de la mejor forma según el escenario en el que vayamos a actuar, lo que nos permitirá tener la mejor gama. de acción y por tanto las mejores oportunidades laborales.

¿Qué es la programación informática?

Algoritmos, programas y lenguajes de programación


Muchos estudiantes de ciencias de la computación o ciencias de la computación piensan, especialmente al principio de sus carreras, que cuando se trata de conjuntos de instrucciones, los algoritmos y los programas son lo mismo.

El Algoritmo y El Programa…

Sin embargo, el algoritmo y el programa son dos cosas completamente diferentes. El algoritmo se puede ilustrar como una idea de resolución de un problema, expresada paso a paso, mientras el programa ejecuta una serie de instrucciones que fueron desarrolladas por el algoritmo.

Asi mismo, el software unicamente es ejecutado por un aparato electrónico que puede ser un telefono inteligente o una computadora, ya que su lenguaje programatico es binario, entre tanto un algoritmo creado en un lenguaje comprensible para los humanos puede ser ejecutado por un humano. Éstas son las principales diferencias.

Un algoritmo…

Un algoritmo, como mencionamos, es un conjunto de instrucciones diseñadas para resolver un problema específico. Básicamente, es un concepto que se puede explicar en nuestro propio idioma mediante diagramas de flujo, que son una descripción gráfica de un algoritmo utilizando varias formas y líneas.

También se pueden explicar con una técnica en la que es necesario especificar entradas y salidas y usar declaraciones en bucle y condicionales como IF llamado pseudocódigo, básicamente una especie de mediador entre nuestro lenguaje natural y el lenguaje de programación.

¿Qué es la programación informática?

En el caso de los programas, software o aplicaciones, como también se les llama, siempre están asociados a la ejecución de algún tipo de dispositivo electrónico, ya que, al estar en código binario, solo pueden ser entendidos por los procesadores que estos dispositivos deben interpretar. y correr. estas instrucciones

Ejemplo de algoritmo

Algoritmo para definir si un triángulo es escaleno, isósceles o equilátero

Datos de entrada: costado1, costado 2, costado 3

Datos de la salida: tipo

si costado 1 = costado 2 y costado 1 = costado 3

es así que

tipo <-triángulo equilatero

ó

si ( costado 1 = costado 2) o ( costado 1 = costado 3) o ( costado 2 = costado 3)

es así que

tipo <- triángulo isósceles

sino

tipo <- triangulo escaleno

Ejemplos de programación


Si estamos dando nuestros primeros pasos en el mundo de la programación y queremos tener toda la información a mano para estar lo más preparados posible, sin duda una de las primeras cosas por las que debemos empezar es conociendo los diferentes lenguajes de programación que existen en el mercado.

Ahora bien, partiendo de este momento hallaremos los lenguajes de programaticos que se suelen usar con mayor frecuencia globalmente por medio de los cuales se puede navegar lo que se logra hacer con ellos, con el fin de saber cuál se adapta mejor a lo que queremos hacer.

¿Qué es la programación informática?

Java


Java es sin duda uno de los lenguajes de programación más populares. Creado por Sun Microsystems en 1995, es uno de los lenguajes de programación más utilizados en todo tipo de implementaciones como diseño web, juegos, aplicaciones móviles y software de control para cientos de miles de dispositivos, entre otros.

Java ofrece ventajas como un lenguaje de programación multiplataforma, código abierto y distribución gratuita, y una extensa biblioteca. Como desventaja para un usuario novato, podemos mencionar su sintaxis, la cual es bastante complicada y algo lenta debido a que necesita ser interpretada.

Ejemplo de programación Java

public class Name_Class

{

public static void main (String args[])

{

//sentencias en bloque;

}

}

JavaScript


JavaScript es un lenguaje de programación ligero que también es multiplataforma y estructurado, y su desarrollo es de tipo «orientado a objetos». Por estas razones, JavaScript es uno de los lenguajes más utilizados por los desarrolladores de sitios web. Como ventajas, podemos decir que JavaScript es seguro y confiable, muy lleno de funciones y opciones, y otras son muy fáciles de usar, por lo que es muy adecuado para cualquier persona que se esté iniciando en la programación. Sin embargo, tiene ciertas desventajas, como ciertas vulnerabilidades relacionadas con la visibilidad de su código, que puede ser leído por cualquier interesado.

¿Qué es la programación informática?

Ejemplo de programación de JavaScript

<!DOCTYPE html>

<html>

<head>

<title>Programa Premium</title>

</head>

<body>

<script>

alert(«Aperturar la Alerta en la ventana»);

document.write(«Dirigir el contenido al archivo HTML»);

</script>

</body>

</html>

C ++


C ++ es un lenguaje de programación de gestión de objetos que fue diseñado para ampliar las capacidades de otro lenguaje «C». C ++ es conocido por los desarrolladores como una de las mejores herramientas de programación, principalmente debido a su flexibilidad y potencia.

Estamos hablando de un lenguaje bastante usado para programar sistemas operativos, bibliotecas y toda clase de aplicativos. También ofrece características como la capacidad de compilar el código que creamos en múltiples plataformas. Las desventajas incluyen la complejidad del uso de las bibliotecas, así como la gestión de la memoria, de la que el desarrollador debe ocuparse. Asimismo, no es un lenguaje que pueda ser útil para desarrollar aplicaciones o páginas web, así como para desarrollar bases de datos, por lo que este no es el mejor lugar para comenzar a programar.

Ejemplo de programación C ++

Longitud del citculo = 2*PI*Radio

Area del círculo= PI*Radio^2

Volumen de la esfera = (4/3)*PI*Radio^3

#include <iostream>

#include <iomanip>

#include <cmath>

using namespace std;

int main(void)

{

const float PI = 3.1416;

float radio;

cout << «Introducir el valor del radio : «;

cin >> radio;

cout << «\nLongitud de la circunferencia: » << fixed << setprecision(2) << 2*PI*radio;

cout << «\nArea del circulo: » << PI*pow(radio,2);

cout << «\nVolumen de la esfera: » << (4.0/3)*PI*pow(radio,3) << endl;

system(«pause»);

PHP


PHP es uno de los lenguajes de programación más utilizados para el desarrollo web, especialmente orientado al desarrollo de aplicaciones web dinámicas, ya que puede integrarse en código HTML. Su principal característica es la facilidad de uso, lo que lo convierte en más que un lenguaje de programación adecuado para cualquier persona nueva en la programación.

¿Qué es la programación informática?

Es un lenguaje muy seguro y confiable ya que su código fuente está oculto tanto para el navegador que lo ejecuta como para el cliente. Pero además de la seguridad, PHP es muy flexible, por lo que puede ser utilizado tanto por programadores experimentados como por principiantes.

Ejemplo de programación PHP

<!DOCTYPE html>

<html>

<head>

<title>Example</title>

</head>

<body>

<?php

echo «¡Hello, I am a script of PHP!»;

?>

</body>

</html>

Si desea saber más sobre PHP, puede obtener más información en este enlace, que lo llevará directamente al sitio oficial de PHP.

Perl


Sin lugar a dudas, Perl es uno de los lenguajes de programación más simples después de JavaScript. Perl se utiliza con mucha diligencia para desarrollar aplicaciones Common Gateway Interface (CGI), que son básicamente una tecnología que permite a un navegador web, en este caso llamado cliente, solicitar datos de cualquier proceso que se ejecute en un servidor web. Algunas de las principales características del lenguaje de programación Perl son su extrema eficiencia y muy buen rendimiento.

Sin embargo, no es necesario que Perl se utilice exclusivamente en el entorno web, ya que también se puede utilizar para el desarrollo en otros entornos. Algunas de las desventajas de Perl son que puede ser lento en comparación con otras herramientas de desarrollo, sin embargo, esto se debe al hecho de que el código se compila al comienzo de la ejecución. Además, su código puede ser difícil de leer, y en muchos casos es muy difícil encontrar y aislar errores para pulir el programa.

Ejemplo de programación de Perl

#!/usr/bin/perl -w

# Storing DNA in a variable, and printing it out

# First we store the DNA in a variable called $DNA

$DNA = ‘ACGGGAGGACGGGAAAATTACTACGGCATTAGC’;

# Next, we print the DNA onto the screen

print $DNA;

# Finally, we’ll specifically tell the program to exit.

exit;

Python


Python es un lenguaje de programación orientado a objetos ampliamente utilizado para desarrollar todo tipo de aplicaciones y juegos tanto para la web como para computadoras de escritorio. Es multiplataforma, gratuito y muy flexible.

En cuanto a los beneficios de Python, podemos mencionar que se integra muy bien con otros lenguajes de programación como Java, C o C ++, entre otros. Como desventajas, podemos mencionar la cantidad insuficiente de documentación, lo cual es muy necesario e importante, especialmente para los usuarios que recién comienzan a programar.

Ejemplo de programación de Python

# Ejercicio 1

print(Jhon)

print(‘Cumpleaños: 12 de marzo)

edad = 33

print(‘Tengo’, edad, ‘años’)

actor = ‘Steven Segal’

comida = ‘Arroz’

ciudad = ‘Lima’

print(‘Me gustan las películas de’, actor)

print(‘Me gusta cenar’, comida)

print(‘Vivo en’, ciudad)

Tipos de programación


Actualmente, existen varios enfoques para la programación de software, que, a su vez, dependerán del lenguaje o técnica utilizada. Estos son los llamados tipos de programación, y tenemos varios a nuestra disposición que podemos utilizar según el proyecto en el que estemos trabajando. Aunque en casi todos los casos el método más utilizado es la programación modular o estructurada, existen varios tipos más, que analizaremos a continuación.

Estos tipos de programación son:

•  Programación estructurada
•  Programación modular
•  Programación lineal
•  Programación orientada a objetos
•  Programación paralela
•  Programacion funcional
•  Programación lógica


A partir de ahora, aprenderemos más sobre cada uno de estos tipos de programación.

 


Programación estructurada


La Programación Estructurada es básicamente un conjunto de técnicas que sin duda permite al programador tener un flujo de trabajo mucho más rápido y eficiente. En la programación estructurada, el software que se está desarrollando es más fácil de entender, no hay necesidad de que las pruebas sean tan complejas. Además, el código de los programas está mucho mejor organizado y documentado.

 

Estas técnicas mejoran en gran medida el rendimiento final del producto, ya que no requieren mucho tiempo de depuración y mantenimiento. Algunas de estas técnicas implican el uso de menos estructuras de control, lo que reduce la cantidad de errores de programación que de otro modo podrían ocurrir.

Diferentes tipos de programación


Otras técnicas utilizadas en programación estructurada:

•  Diseño de arriba hacia abajo 
•  Recursos abstractos
•  Estructuras básicas, de las que hay tres tipos: E. secuenciales, E. selectivas y E. repetidas.


Programación modular


Otro tipo de programación muy conocido es la denominada programación modular, que es esencialmente un paradigma de programación. Para comprender qué es la programación mediante programación modular, debe dividir su programa en módulos o subrutinas más específicos. Este tipo de programación se diseñó con el objetivo principal de hacer que el código sea mucho más legible y manejable.

En este tipo de programación, el programa principal se encarga de coordinar las llamadas a los módulos secundarios. Después de eso, transfiere los datos necesarios en forma de parámetros. Cabe señalar que cada módulo puede contener sus propios datos y llamar a otros módulos o funciones.


Todo esto significa que cuando aplicamos programación modular, cualquier programa complejo se puede dividir en muchas partes. En otras palabras, un programa grande se puede dividir en partes más pequeñas. Esto tiene muchas ventajas a la hora de buscar errores o cambiar un fragmento de código.

Operaciones básicas de programación modular

•  Entrada: parámetro
•  Proceso: subrutina o función
•  Salida: valor de retorno


Programación lineal


En el campo de la programación, la programación lineal se conoce como un método matemático para optimizar o minimizar una función lineal objetiva. Esto se hace para que las variables de la función anterior estén vinculadas a un cierto conjunto de restricciones. Estas restricciones se expresan mediante un sistema de ecuaciones o desigualdades que también son lineales.


En los modelos de programación lineal, se establece que las variables de decisión como la función objetivo y las restricciones corresponden a un tipo de comportamiento lineal. Por lo tanto, puede simplificar los cálculos y obtener resultados cercanos a los reales.

El modelo más utilizado para resolver problemas de programación lineal es el llamado «método simplex».

Programación orientada a objetos


La programación orientada a objetos es esencialmente una técnica que puede mejorar el desarrollo de software en términos de velocidad y confiabilidad. Esta mejora de desarrollo se debe a la reutilización de objetos que ya están cargados en el programa.

Como podemos explicar, el elemento principal de POO es un objeto, que es básicamente una colección de datos y programas. Tienen estructura y son parte de una organización más grande. Estos objetos pueden contener varios tipos de datos, todos están estructurados. Pueden ser visibles o invisibles según las necesidades del programador y del software.

El polimorfismo y la herencia son unas de las primordiales señas de la programación dirigida a objetos.

Programación paralela


En el campo del desarrollo de software, la programación paralela es de hecho un tipo de programación ampliamente utilizado. Lo utiliza un desarrollador cuando necesita realizar varias tareas al mismo tiempo. Entre las tareas que se pueden realizar se encuentra la capacidad de controlar el acceso de múltiples usuarios a los sistemas y software.

Si bien este es un tipo de programación mucho más complejo, la verdad es que, cuando se hace correctamente, los resultados serán mejores. En otras palabras, con este método, puede mejorar significativamente el rendimiento del software que se está desarrollando. Esto se debe a que en la programación en paralelo se pueden desarrollar tareas sin esperar la cola de ejecución.


Sin embargo, la programación paralela también puede tener ciertas desventajas. Un ejemplo de esto ocurre cuando tenemos la necesidad de comunicarnos entre tareas, pero como mencionamos, una implementación bien implementada puede ser una gran ventaja en muchos entornos.

Sin embargo, la programación paralela también puede tener ciertas desventajas. Un ejemplo de esto ocurre cuando tenemos la necesidad de comunicarnos entre tareas, pero como mencionamos, una implementación bien implementada puede ser una gran ventaja en muchos entornos.

Programacion funcional


Al igual que la programación modular, la programación funcional es un paradigma de programación, lo que significa que es una forma de resolver problemas de programación. Cuando un desarrollador usa este paradigma, trabaja mayoritariamente con funciones, evitando todo tipo de datos variables, además de prevenir el intercambio de estado entre funciones.

En la programación funcional, todas las funciones se tratan como «ciudadanos» de primera clase. Estas funciones se pueden asignar a variables, que a su vez se pueden utilizar como entradas y salidas para muchas otras funciones. Son consideradas funciones de orden superior todas aquellas que logran agarrar funciones vistas como parámetros y regresarlas como resultado

Esencialmente, la premisa es que la programación funcional es lo que los expertos consideran un «paradigma declarativo». Esto se debe a que el programador se centra en «lo» que está haciendo, no en cómo puede considerarse un «enfoque imperativo».

Todo esto significa que el programador expresará su lógica sin necesidad de describir el control de flujo, es decir, no usaremos bucles ni condicionales.

Programación lógica


Podemos decir que la programación lógica es un tipo de paradigma de programación dentro del paradigma de programación declarativa. Actualmente, este tipo de programación es muy utilizado en el desarrollo de inteligencia artificial. ¿Qué es la programación lógica? Se trata de utilizar una metodología basada en predicados, que es una teoría matemática. Con la ayuda de esta teoría, se logra que la computadora pueda dar soluciones utilizando reglas y hechos lógicos.


En este sentido, la programación lógica debe ofrecer herramientas de programación únicas de este paradigma que permitan desarrollar la IA de una manera más flexible. En este sentido, hoy en día la mayoría de las aplicaciones de inteligencia artificial se desarrollan en este lenguaje por este mismo motivo. Esto se debe principalmente a que la programación lógica es muy diferente de cómo pensamos en la mayoría de los lenguajes de programación comunes. Básicamente, lo que la programación lógica está tratando de replicar es el pensamiento humano, por lo que organizar los pensamientos de esta manera es más natural que en los lenguajes tradicionales. Sin embargo, esto requiere un mayor nivel de abstracción.

En la programación lógica, una persona no piensa en estructuras de bajo nivel, como tareas y repeticiones, sino en términos de premisas y conclusiones, llegando a la solución de un problema utilizando un conjunto de axiomas lógicos.

Deja una respuesta

Tu dirección de correo electrónico no será publicada. Los campos obligatorios están marcados con *